Prev. |  KEGG KO K11980 > 

RIKEN DNA Bank Human Resource - RNF11

Gene ID NCBI Gene 26994 |  KEGG hsa:26994
Gene Symbol RNF11
Protein Name ring finger protein 11
Synonyms CGI-123|SID1669
Ortholog resource in our bank

  RNF11

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX009163 IRAK022P03 pCMV-SPORT6 BC020964 NM_014372 Full
HGY036327 IRAK090N15 pBluescript BC047654 NM_014372 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR203486 ARiS008L22 pGCAP10 NM_014372.4  
GGGAGTAGGATGAGGCCCGCGGCCGTGGCTCCGGCGTCGGCGGGGGCAGCAGCAGCTGAG
HKR264457 ARiS161C09 pGCAP10 NM_014372.4  
GCTCGTTCTGGCTGCCGCCGTCTCGCTGAGGCGGAGTAGGATGAGGCCCGCGGCCGTGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl