Prev. |  KEGG KO K15978 > 

RIKEN DNA Bank Human Resource - AKAP8L

Gene ID NCBI Gene 26993 |  KEGG hsa:26993
Gene Symbol AKAP8L
Protein Name A-kinase anchoring protein 8 like
Synonyms HA95|HAP95|NAKAP|NAKAP95
Ortholog resource in our bank

  AKAP8L

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082857 IRAL007C09 pOTB7 BC000713 NM_014371 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR061203 ARe53A03 pKA1U5 NM_014371.2  
GGTCGGATGTTCAGAGCAGCAGAAGCCGGCGTCGCTCGGATGTTGTGTTGCCCGCCACCA
HKR070507 ARe76E11 pKA1U5 NM_014371.2  
GATCGCAGCGTCGGATGTTCAGAGCAGCAGAACCCNTTNGATCGTCGGATGTTGTGTTGC
HKR368054 RBd20C06 pGCAP10 NM_014371.2  
GATCGCATCGTCGGATGTTCAGAGCAGCAGAAGCCGGCGTCGTCGGATGTTGTGTTGCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl