Prev. |  KEGG KO K16729 > 

RIKEN DNA Bank Human Resource - CHORDC1

Gene ID NCBI Gene 26973 |  KEGG hsa:26973
Gene Symbol CHORDC1
Protein Name cysteine and histidine rich domain containing 1
Synonyms CHP1
Ortholog resources KEGG ortholog (KEGG orthology K16729) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX069952 IRAK174O16 pCMV-SPORT6 BC072461 NM_012124 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR043745 ARe09G01 pKA1U5 NM_012124.1  
GCTTCTCTTGTCTGTCACCACGNTGAGATGTGCTTTTCACCTTCCACCATGATTGTGGGG
HKR050898 ARe27E02 pKA1U5 NM_012124.1  
GGTCAGACCGGTGCTAGCGACACGGGAGTGGCAAACGCATCCTCTTGCCGTTCCCGGTGT
HKR065681 ARe64D09 pKA1U5 NM_012124.1  
TGAGTCGTCAGACCGGTGCTAGCGACACGGGAGTGGCAAACGCATCCTCTTGCCGTTCCC
HKR219967 ARiS049P07 pGCAP10 NM_012124.1  
GAGACCGGTGCTAGCGACACGGGAGTGGCAAACGCATCCTCTTGCCGTTCCCGGTGTTTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl