Prev. | 

RIKEN DNA Bank Human Resource - RANBP6

Gene ID NCBI Gene 26953 |  KEGG hsa:26953
Gene Symbol RANBP6
Protein Name RAN binding protein 6
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR420467 RBdS051C19 pGCAP10 NM_012416.2  
GAGAGCGCAATGGCGGCAACCGCGTCTGCAGGGGTGCCGGCGACCGTGTCAGAAAAGCAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl