Prev. |  KEGG KO K20523 > 

RIKEN DNA Bank Human Resource - SH3YL1

Gene ID NCBI Gene 26751 |  KEGG hsa:26751
Gene Symbol SH3YL1
Protein Name SH3 and SYLF domain containing 1
Synonyms RAY
Ortholog resource in our bank

  SH3YL1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX035892 IRAK089M04 pCMV-SPORT6 BC043403 NM_015677 Partial/var
HGY086424 IRAL016A24 pDNR-LIB BC008374 NM_015677 Partial
HGY086566 IRAL016G22 pDNR-LIB BC008375 NM_015677 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE082014 M01C005A14 pDONR221 04-134-2_3-B07 AK026586 NM_015677  
HGE082062 M01C005C14 pDONR221 04-134-2_3-B07 AK026586 NM_015677  
HGE082110 M01C005E14 pDONR221 04-134-2_3-B07 AK026586 NM_015677  
HGE082158 M01C005G14 pDONR221 04-134-2_3-B07 AK026586 NM_015677  
HGE082206 M01C005I14 pDONR221 04-134-2_3-B07 AK026586 NM_015677  
HGE082254 M01C005K14 pDONR221 04-134-2_3-B07 AK026586 NM_015677  
HGE082302 M01C005M14 pDONR221 04-134-2_3-B07 AK026586 NM_015677  
HGE082350 M01C005O14 pDONR221 04-134-2_3-B07 AK026586 NM_015677  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR362810 RBd07A10 pGCAP10 NM_015677.1  
CGGCCGGCCGATGGCGCAATCGGCTCCAGTGCGCCTGCGGAGGCGGTCCTATGACGTGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl