Prev. |  KEGG KO K16769 > 

RIKEN DNA Bank Human Resource - CKAP2

Gene ID NCBI Gene 26586 |  KEGG hsa:26586
Gene Symbol CKAP2
Protein Name cytoskeleton associated protein 2
Synonyms LB1|TMAP|se20-10
Ortholog resources KEGG ortholog (KEGG orthology K16769) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR243618 ARiS109A18 pGCAP10 NM_018204.3  
GAGCCGCGGTGCAGACTGCGGCGGCGGTGGTCTGAGGAAGTTCTATCTTGGCGCTAAAGC
HKR247281 ARiS118D09 pGCAP10 NM_018204.3  
GAGCCGCGGTGCAGACTGCGGCGGCGGTGGTCTGAGGAAGTTCTATCTTGGCGCTAAAGC
HKR368811 RBd22A11 pGCAP10 NM_018204.3  
GGCAGACTGCGGCGGCGGTGGTCTGAGGANTTCTATCTTGGCGCTAAAGCGGAGACGCAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl