Prev. |  KEGG KO K19365 > 

RIKEN DNA Bank Human Resource - BSCL2

Gene ID NCBI Gene 26580 |  KEGG hsa:26580
Gene Symbol BSCL2
Protein Name BSCL2, seipin lipid droplet biogenesis associated
Synonyms GNG3LG|HMN5|PELD|SPG17
Ortholog resources KEGG ortholog (KEGG orthology K19365) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY097781 IRAL044H13 pOTB7 BC041640 NM_032667 Full
HGY084733 IRAL011N21 pOTB7 BC004911 NM_032667 Full
HGY090105 IRAL025E09 pOTB7 BC009866 NM_032667 Full/var
HGY091762 IRAL029G18 pOTB7 BC012140 NM_032667 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR165770 ARi14H02 pGCAP10 NM_032667.5  
GGCTGTACGACTGCACTCCCGCACCCTCCCCTAAATCCCCCCTCTTCGGCCTGTTTACCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl