Prev. |  KEGG KO K14411 > 

RIKEN DNA Bank Human Resource - DAZAP1

Gene ID NCBI Gene 26528 |  KEGG hsa:26528
Gene Symbol DAZAP1
Protein Name DAZ associated protein 1
Synonyms -
Ortholog resource in our bank

  DAZAP1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY091645 IRAL029B21 pOTB7 BC012062 NM_018959 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE025161 W01A062P01 pENTR-TOPO IRAL029B21 BC012062 NM_018959  
HGE025163 W01A062P03 pENTR-TOPO IRAL029B21 BC012062 NM_018959  
HGE025165 W01A062P05 pENTR-TOPO IRAL029B21 BC012062 NM_018959  
HGE025167 W01A062P07 pENTR-TOPO IRAL029B21 BC012062 NM_018959  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR163731 ARi09F11 pGCAP10 NM_018959.2  
GGCGGTGACCGTTGGCGCCGAGGGGAGGAGGCAGCCGCCGCCGCCGCCGCCGCCGCCGCC
HKR170030 ARi25B06 pGCAP10 NM_018959.2  
CGGCCGGCCGATGGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGTTGCGCAGATCCG
HKR345755 RBb64G11 pGCAP1 NM_018959.2  
GGTGACCGTTGGCGCCGAGGGGAGGAGGCAGCCGCCGCCGCCGCCGCCGCCGCCGCCGCC
HKR366426 RBd16B02 pGCAP10 NM_018959.2  
GGGAGCTCGCACATGCGGCTGCCGCTCCAGCCGCCCGGGCCCCGCCGCCGCCGCCGCCGC
HKR398434 RBd96B10 pGCAP10 NM_018959.2  
GGGGCGTGCGCAGGGGCGGCGGCGCGGCGGCGCGGGGACGCGCGGTGACCGTCGGCGCCG
HKR402854 RBdS007C06 pGCAP10 NM_018959.2  
GGGACGCGCGGTGACCNTTGGCGCCGAGGGGAGGAGGCAGCCGCCGCCGCCGCCGCCGCC
HKR475106 RBdS187M18 pGCAP10 NM_018959.2  
GAGGGGCGGCGGCGCGGCGGCGCGGGGACGCGCGGTGACCGTTGGCGCCGAGGGGAGGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl