Prev. |  KEGG KO K17779 > 

RIKEN DNA Bank Human Resource - TIMM10B

Gene ID NCBI Gene 26515 |  KEGG hsa:26515
Gene Symbol TIMM10B
Protein Name translocase of inner mitochondrial membrane 10B
Synonyms FXC1|TIM10B|Tim9b
Ortholog resource in our bank

  TIMM10B

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY087668 IRAL019C20 pDNR-LIB BC011014 NM_012192 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR053774 ARe34H06 pKA1U5 NM_012192.3  
GATGCGCCGGTGGCGTGATGGAGCGGCAGCAGCAGCAGCAACAGCAACTGCGAAACCTGC
HKR185307 ARi63E11 pGCAP10 NM_012192.3  
GATGCGCCGGTGGCGTGATGGAGCGGCAGCAGCAGCAGCAACAGCAACTGCGAAACCTGC
HKR218048 ARiS045B24 pGCAP10 NM_012192.3  
GATGCGCCGGTGGCGTGATGGANCGGCAGCAGCAGCAGCAACAGCAACTGCGAAACCTGC
HKR363348 RBd08G04 pGCAP10 NM_012192.3  
GATGCGCCGGTGGCGTGATGGAGCGGCAGCAGCAGCAGCAACAGCAACTGCGAAACCTGC
HKR396402 RBd91A02 pGCAP10 NM_012192.3  
GGGTGGCGTGATGGAGCGGCAGCAGCAGCAGCAACAGCAACTGCGAAACCTGCGTGACTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl