Prev. |  KEGG KO K16302 > 

RIKEN DNA Bank Human Resource - CNNM3

Gene ID NCBI Gene 26505 |  KEGG hsa:26505
Gene Symbol CNNM3
Protein Name cyclin and CBS domain divalent metal cation transport mediator 3
Synonyms ACDP3
Ortholog resource in our bank

  CNNM3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX011647 IRAK029B23 pCMV-SPORT6 BC022944 NM_199078 Partial
HGY013347 IRAK033G03 pBluescriptR BC037272 NM_017623 Full
HGY087240 IRAL018B16 pOTB7 BC007199 NM_199078 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE089227 M01C023B03 pDONR221 MGC01-C02 BC037272 NM_017623  
HGE089275 M01C023D03 pDONR221 MGC01-C02 BC037272 NM_017623  
HGE089323 M01C023F03 pDONR221 MGC01-C02 BC037272 NM_017623  
HGE089371 M01C023H03 pDONR221 MGC01-C02 BC037272 NM_017623  
HGE089419 M01C023J03 pDONR221 MGC01-C02 BC037272 NM_017623  
HGE089467 M01C023L03 pDONR221 MGC01-C02 BC037272 NM_017623  
HGE089515 M01C023N03 pDONR221 MGC01-C02 BC037272 NM_017623  
HGE089563 M01C023P03 pDONR221 MGC01-C02 BC037272 NM_017623  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE038849 W01A097C01 pENTR-TOPO IRAL018B16 BC007199 NM_199078  
HGE038851 W01A097C03 pENTR-TOPO IRAL018B16 BC007199 NM_199078  
HGE048042 W01A120B18 pENTR-TOPO IRAL018B16 BC007199 NM_199078  
HGE048048 W01A120B24 pENTR-TOPO IRAL018B16 BC007199 NM_199078  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR375729 RBd39F09 pGCAP10 NM_017623.4  
CGGCCGGCCGATGAGAGGCCGAGAGGGGGCAGCAGGCGATGGCGGCGGCGGTAGCTGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl