Prev. | 

RIKEN DNA Bank Human Resource - FAM162A

Gene ID NCBI Gene 26355 |  KEGG hsa:26355
Gene Symbol FAM162A
Protein Name family with sequence similarity 162 member A
Synonyms C3orf28|E2IG5|HGTD-P
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY087777 IRAL019H09 pDNR-LIB BC015060 NM_014367 Full/var
HGY087872 IRAL019L08 pDNR-LIB BC010896 NM_014367 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR050945 ARe27G01 pKA1U5 NM_014367.3  
GACTCCAACGCTGGGTGACATTGAGCTCACCAGCGCCACCGNTCCCCGGCGAAGTTCTGC
HKR060010 ARe50A10 pKA1U5 NM_014367.3  
TGGAAGTTCTGCGCTGGTCGGCGGAGTAGCAAGTGGCCATGGGGAGCCTCAGCGGTCTGC
HKR167355 ARi18G11 pGCAP10 NM_014367.3  
GGTCCTTCCCACTCCAACGCTGGGTGACATTGAGCTCACCAGCGCCACCGTCCCCGGCGA
HKR168973 ARi22H05 pGCAP10 NM_014367.3  
GGTCCTTCCCACTCCAACGCTGGGTGACATTGAGCTCACCANGCGCCACCGTCCCCGGCG
HKR234158 ARiS085G14 pGCAP10 NM_014367.3  
GGGCGAAGTTCTGCGCTGGTCGGCGGAGTAGCAAGTGGCCATGGGGAGCCTCAGCGGTCT
HKR366580 RBd16H12 pGCAP10 NM_014367.3  
GACTCCAACGCTGGGTGACATTGAGCTCACCAGCGCCACCGTCCCCGGCGAAGTTCTGCG
HKR366926 RBd17F06 pGCAP10 NM_014367.3  
GACTCCAACGCTGGGTGACATTGAGCTCACCAGCGCCACCGTCCCCGGCGAAGTTCTGCG
HKR392928 RBd82F08 pGCAP10 NM_014367.3  
GGGCGAAGTTCTGCGCTGGTCGGCGGAGTAGCAAGTGGCCATGGGGAGCCTCAGCGGTCT
HKR470988 RBdS177H20 pGCAP10 NM_014367.3  
GCCGGCGAAGTTCTGCGCTGGTCGGCGGAGTAGCAAGTGGCCATGGGGAGCCTCAGCGGT
HKR471098 RBdS177M10 pGCAP10 NM_014367.3  
GACCGTCCCCGGCGAAGTTCTGCGCTGGTCGGCGGAGTAGCAAGTGGCCATGGGGAGCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl