Prev. |  KEGG KO K14538 > 

RIKEN DNA Bank Human Resource - GNL3

Gene ID NCBI Gene 26354 |  KEGG hsa:26354
Gene Symbol GNL3
Protein Name G protein nucleolar 3
Synonyms C77032|E2IG3|NNP47|NS
Ortholog resources KEGG ortholog (KEGG orthology K14538) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082361 IRAL005P01 pOTB7 BC001024 NM_206826 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR342969 RBb57H01 pGCAP1 NM_014366.4  
AGTTCCACGTGGCGCCAGCGGAGGCAGGTTGCTGTGTTTGTGCTTCCTTCTACAGCCAAT
HKR344571 RBb61H03 pGCAP1 NM_014366.4  
AAATGTGAGTTCAGTTCACACGTGGCGCCAGCGGAGGCAGGTTGCTGTGTTTGTGCTTCC
HKR365748 RBd14G04 pGCAP10 NM_014366.4  
GGCTCGTCAGTGGCTTCAGTTCACACGTGGCGCCNGCGGAGGCAGGTTGATGTGTTTGTG
HKR366455 RBd16C07 pGCAP10 NM_014366.4  
AAGTGCGTGACGCTCGTCAGTGGCTTCAGTTCACACGTGGCGCCAGCGGAGGCAGGTTGC
HKR371679 RBd29D07 pGCAP10 NM_014366.4  
GACACGTGGCGCCAGCGGAGGCAGGTTGCTGTGTTTGTGCTTCCTTCTACAGCCAATATG
HKR392577 RBd81H09 pGCAP10 NM_014366.4  
GAGTTCACACGTGGCGCCAGCGGAGGCAGGTTGATGTGTTTGTGCTTCCTTCTACAGCCA
HKR428022 RBdS070A22 pGCAP10 NM_014366.4  
GAGTTCACACGTGGCGCCAGCGGAGGCAGGTTGCTGTGTTTGTGCTTCCTTCTACAGCCA
HKR474855 RBdS187C07 pGCAP10 NM_014366.4  
GAGTTCACACGTGGCGCCAGCGGAGGCAGGTTGCTGTGTTTGTGCTTCCTTCTACAGCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl