Prev. |  KEGG KO K17592 > 

RIKEN DNA Bank Human Resource - SACS

Gene ID NCBI Gene 26278 |  KEGG hsa:26278
Gene Symbol SACS
Protein Name sacsin molecular chaperone
Synonyms ARSACS|DNAJC29|PPP1R138|SPAX6
Ortholog resource in our bank

  SACS

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY031015 IRAK077I23 pBluescriptR BC039418 NM_014363 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE014657 W01A036K17 pENTR-TOPO flj0014c20 AK090599 NM_014363  
HGE014663 W01A036K23 pENTR-TOPO flj0014c20 AK090599 NM_014363  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR072947 ARe82G03 pKA1U5 NM_014363.4  
GGCTCCTCGGCCGCCGCGGCTTCCTCTAGCGTTTCCTCCTCGGCGCGGGCTGCTGCGTAC
HKR164969 ARi12H01 pGCAP10 NM_014363.4  
GCTCCTCGGCGCGGGCTGCTGCGTACGGGACTGCGCCATGCGGATCCCGCCCTCCCGGCC
HKR170580 ARi26H12 pGCAP10 NM_014363.4  
GGTTTTTCCTCCTCGGCGCGGGCTGCTGCGTACGGGACTGCGCCATGCGGATCCCGCCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl