Prev. |  KEGG KO K05605 > 

RIKEN DNA Bank Human Resource - HIBCH

Gene ID NCBI Gene 26275 |  KEGG hsa:26275
Gene Symbol HIBCH
Protein Name 3-hydroxyisobutyryl-CoA hydrolase
Synonyms HIBYLCOAH
Ortholog resources KEGG ortholog (KEGG orthology K05605) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY067069 IRAK167L05 pBluescriptR BC067822 NM_014362 Full/var
HGY086699 IRAL016M11 pDNR-LIB BC005190 NM_198047 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR171627 ARi29B03 pGCAP10 NM_014362.2  
GTGCTTTAGCTTCGGAGTGTTTGGCGACGGGGCAGCGCGAGATGTGGAGGCTCATGTCGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl