Prev. |  KEGG KO K10292 > 

RIKEN DNA Bank Human Resource - FBXO5

Gene ID NCBI Gene 26271 |  KEGG hsa:26271
Gene Symbol FBXO5
Protein Name F-box protein 5
Synonyms EMI1|FBX5|Fbxo31
Ortholog resources KEGG ortholog (KEGG orthology K10292) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY086086 IRAL015D14 pOTB7 BC018905 NM_012177 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR081774 ARf04H06 pKA1U5 NM_012177.3  
GTTAAGAGATACAGGTCTGTGAAGCAGGCAGGTTGCTCAGCTGCCCCCGGAGCGGTTCCT
HKR082128 ARf05F08 pKA1U5 NM_012177.3  
GTTAAGAGATACAGGTCTGTGAAGCAGGCAGGTTGCTCAGCTGCCCCCGGAGCGGTTCCT
HKR235105 ARiS087M17 pGCAP10 NM_012177.3  
CGGCCGGCCGATGAGCAGAGCGCGCGCGTAAATCCTAGAGAGGCGGGCTAAGCTGGACTG
HKR326803 RBb17A03 pKA1U5 NM_012177.3  
GTTAAGAGATACAGGTCTGTGAAGCAGGCAGGTTGCTCAGCTGCCCCCGGAGCGGTTCCT
HKR330576 RBb26H08 pGCAP1 NM_012177.3  
GATACAGGTCTGTGAAGCAGGCAGGTTGCTCAGCTGCCCCCGGAGCGGTTCCTCCACCTG
HKR366946 RBd17G02 pGCAP10 NM_012177.3  
GACAGGTCTGTGAAGCAGGCAGGTTGCTCAGCTGCCCCCGGAGCGGTTCCTCCACCTGAG
HKR371208 RBd28A08 pGCAP10 NM_012177.3  
GACAGGTCTGTGAAGCAGGCAGGTTGCTCAGCTGCCCCCGGAGCGGTTCCTCCACCTGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl