Prev. |  KEGG KO K10302 > 

RIKEN DNA Bank Human Resource - FBXO22

Gene ID NCBI Gene 26263 |  KEGG hsa:26263
Gene Symbol FBXO22
Protein Name F-box protein 22
Synonyms FBX22|FISTC1
Ortholog resources KEGG ortholog (KEGG orthology K10302) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX027815 IRAK069I23 pCMV-SPORT6 BC032540 NM_147188 Full/var
HGX033163 IRAK082P03 pCMV-SPORT6 BC039024 NM_147188 Full/var
HGX033713 IRAK084E17 pCMV-SPORT6 BC041691 NM_147188 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR168482 ARi21D10 pGCAP10 NM_147188.1  
GGAGCCGCCGTAAGACTGGTTCCGGCGGGCTGGTGAGGAATGGAGCCGGTAGGCTGCTGC
HKR205438 ARiS013J22 pGCAP10 NM_147188.1  
GCTATGCTGGCGTAATCGGGTTCCTCCGAGCCGCCGTAGGACTGGTTCCGGCGGGCTGGT
HKR327778 RBb19H10 pKA1U5 NM_147188.1  
GAGTGCGCGCCGGCCGGGCAACCCTATGCTGGCGTAATCGGGTTCCTCCGAGCCGCCGTA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl