Prev. |  KEGG KO K10264 > 

RIKEN DNA Bank Human Resource - FBXW8

Gene ID NCBI Gene 26259 |  KEGG hsa:26259
Gene Symbol FBXW8
Protein Name F-box and WD repeat domain containing 8
Synonyms FBW6|FBW8|FBX29|FBXO29|FBXW6
Ortholog resource in our bank

  FBXW8

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY018569 IRAK046H01 pBluescriptR BC037296 NM_153348 Full/var
HGY030705 IRAK076M17 pBluescriptR BC045190 NM_153348

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR373225 RBd33B01 pGCAP10 NM_012174.1  
GGGCCGCGGCGGACACTTCCCTGGGCGGGACTGTCTCGTGGCACCCGGTGGAACCGAGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl