Prev. |  KEGG KO K10271 > 

RIKEN DNA Bank Human Resource - FBXL5

Gene ID NCBI Gene 26234 |  KEGG hsa:26234
Gene Symbol FBXL5
Protein Name F-box and leucine rich repeat protein 5
Synonyms FBL4|FBL5|FLR1
Ortholog resource in our bank

  FBXL5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY018885 IRAK047D13 pBluescriptR BC030656 NM_033535 Full/var
HGY091875 IRAL029L11 pOTB7 BC012320 NM_033535 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR208291 ARiS020M03 pGCAP10 NM_012161.2  
GGGCGAGGGTGTCTATGGAGAGGCGGCGGCCGCGGCTGCTGAGGCGGAGGCTGAGGCAGT
HKR219953 ARiS049O17 pGCAP10 NM_012161.2  
GGCGGCNANGGTGTCTATGGAGAGGCGGCGGCCGCGGCTGCTGAGGCGGAGGCTGAGGCA
HKR248831 ARiS122B07 pGCAP10 NM_012161.2  
GGGAGAGGCGGCGGCCGCGGCTGCTGAGGCGGAGGCTGAGGCAGTGGCGATGGCGCCCTT
HKR396973 RBd92H05 pGCAP10 NM_012161.2  
GGCCTCTGAGCTGGTGGGCGGGCCGGATGTAGCCGAGCGCGGACAGGGCTAGTCCGGACA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl