Prev. |  KEGG KO K10158 > 

RIKEN DNA Bank Human Resource - B3GAT3

Gene ID NCBI Gene 26229 |  KEGG hsa:26229
Gene Symbol B3GAT3
Protein Name beta-1,3-glucuronyltransferase 3
Synonyms GLCATI|JDSCD|glcUAT-I
Ortholog resource in our bank

  B3GAT3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX017051 IRAK042K11 pCMV-SPORT6 BC019832 NM_012200 Full/var
HGY088267 IRAL020L03 pOTB7 BC007906 NM_012200 Full
HGY103438 IRAL058J22 pOTB7 BC071961 NM_012200 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE001321 W01A003F01 pENTR-TOPO IRAL020L03 BC007906 NM_012200  
HGE001323 W01A003F03 pENTR-TOPO IRAL020L03 BC007906 NM_012200  
HGE001325 W01A003F05 pENTR-TOPO IRAL020L03 BC007906 NM_012200  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR175348 ARi38G04 pGCAP10 NM_012200.2  
GAGACCCCGCCTGCTCGGGCGCGGGCGGCGGCGCGGCCATGAAGCTGAAGCTGAAGAACG
HKR322410 RBb06A10 pKA1U5 NM_012200.2  
GGCAGACCCCGCCTGCTCGGGCGCGGGCGGCGGCGCGGCCATGAAGCTGAAGCTGAAGAA
HKR337726 RBb44F06 pGCAP1 NM_012200.2  
GACCCCATCACTCTCTTTGTTGCACTTAGCCCTCAGGGNTACAGCTCAAGGAGAGCTCTT
HKR339752 RBb49G08 pGCAP1 NM_012200.2  
GGCAGGGGCGGGGCCTGCGGACAGGAGCCGGGGTTTGGGGCGGGAACCCCTCGTCCCCTG
HKR364100 RBd10E04 pGCAP10 NM_012200.2  
GGACCCCGCCTGCTCGGGCGCGGGCGGCGGCGCGGCCATGAAGCTGAAGCTGAAGAACGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl