Prev. |  KEGG KO K11796 > 

RIKEN DNA Bank Human Resource - TRPC4AP

Gene ID NCBI Gene 26133 |  KEGG hsa:26133
Gene Symbol TRPC4AP
Protein Name transient receptor potential cation channel subfamily C member 4 associated protein
Synonyms C20orf188|PPP1R158|TRRP4AP|TRUSS
Ortholog resource in our bank

  TRPC4AP

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001687 IRAK004D15 pCMV-SPORT6 BC001323 NM_199368 Partial
HGY088009 IRAL020A09 pOTB7 BC008836 NM_199368 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR063305 ARe58E09 pKA1U5 NM_015638.2  
GGCTTCCTGTTTGTCCGACGAGGAGACATGGCGGCGGCGCCGGTAGCGGCTGGGTCTGGA
HKR075753 ARe89G09 pKA1U5 NM_015638.2  
GGTAGAAATCTCCGCGGCCCCGAGGCCGCTTGCTTCCTGATTTGTCCGACGAGGAGACAT
HKR174154 ARi35G10 pGCAP10 NM_015638.2  
GGCTTCCTGTTTGTCCGACGAGGAGACATGGCGGCGGCGCCGGTAGCGGCTGGGTCTGGA
HKR333231 RBb33B07 pGCAP1 NM_015638.2  
GGTAGAAATCTCCGCGGCCCCGAGGCCGCTTGCTTCCTGTTTGTCCGACGAGGAGACATG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl