Prev. |  KEGG KO K19382 > 

RIKEN DNA Bank Human Resource - TCTN3

Gene ID NCBI Gene 26123 |  KEGG hsa:26123
Gene Symbol TCTN3
Protein Name tectonic family member 3
Synonyms C10orf61|JBTS18|OFD4|TECT3
Ortholog resource in our bank

  TCTN3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX056409 IRAK141A09 pCMV-SPORT6 BC061582 NM_001013840 Partial/var
HGY067314 IRAK168E18 pBluescriptR BC068449 NM_001013840 Full
HGY090144 IRAL025F24 pOTB7 BC009494 NM_001013840 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR051725 ARe29F05 pKA1U5 NM_015631.5  
TGCCCGGAGGCCCTGAATGCCCCATGCGCACCCCACAGCTCGCGCTCCTGCAAGTGTTCT
HKR184180 ARi60H12 pGCAP10 NM_015631.5  
GGGACCCGGAGGCCCTGAATGCCCCATGACCACCCCNCNGCTCGCGCTCCTGCAAGTGTT
HKR380952 RBd52G08 pGCAP10 NM_015631.5  
GGGACCCGGAGGCCCTGAATGCCCCATGCGCACCCCACAGCTCGCGCTCCTGCAAGTGTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl