Prev. |  KEGG KO K10341 > 

RIKEN DNA Bank Human Resource - WSB1

Gene ID NCBI Gene 26118 |  KEGG hsa:26118
Gene Symbol WSB1
Protein Name WD repeat and SOCS box containing 1
Synonyms SWIP1|WSB-1
Ortholog resources KEGG ortholog (KEGG orthology K10341) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY096224 IRAL040J08 pOTB7 BC021110 NM_015626 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR023708 ARa59E12 pKA1U5 NM_015626.8  
GAGTGTCTCGTTTGCAGTCGGCGCTTTAGGGGAACTGTCTTCCTCCGCAGGCGCGAGGCT
HKR360828 RBd02B04 pGCAP10 NM_015626.8  
GAGTGTCTCGTTTGCAGTCGGCGCTTTAGGGGAACTGTCTTCCTCCGCAGGCGCGAGGCT
HKR365274 RBd13D02 pGCAP10 NM_015626.8  
GGCCCCTGCCGCCCAGATATCTCCGGCGCCGCCCGCCATTTTGACTCCAGTGTCTCGTTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl