Prev. |  KEGG KO K17908 > 

RIKEN DNA Bank Human Resource - WIPI2

Gene ID NCBI Gene 26100 |  KEGG hsa:26100
Gene Symbol WIPI2
Protein Name WD repeat domain, phosphoinositide interacting 2
Synonyms ATG18B|Atg21|CGI-50|IDDSSA|WIPI-2
Featured content Autophagy (human)
Ortholog resource in our bank

  WIPI2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY085710 IRAL014E14 pOTB7 BC004116 NM_015610 Full
HGY086318 IRAL015N06 pOTB7 BC021200 NM_015610 Full
HGY089073 IRAL022L09 pOTB7 BC007596 NM_016003 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR072102 ARe80E06 pKA1U5 NM_001033518.1  
ATCCTGGAAGAGCGGGGACGGGATGAGGCGGCGGTTGATCCCAGGGNTGGCGAGTGGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl