Prev. | 

RIKEN DNA Bank Human Resource - SZRD1

Gene ID NCBI Gene 26099 |  KEGG hsa:26099
Gene Symbol SZRD1
Protein Name SUZ RNA binding domain containing 1
Synonyms C1orf144
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX056108 IRAK140E12 pCMV-SPORT6 BC065538 NM_015609 Full
HGY092468 IRAL031C20 pDNR-LIB BC023988 NM_015609 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE096803 M01C042A03 pDONR221 MGC10-E02 BC023988 NM_015609  
HGE096851 M01C042C03 pDONR221 MGC10-E02 BC023988 NM_015609  
HGE096899 M01C042E03 pDONR221 MGC10-E02 BC023988 NM_015609  
HGE096947 M01C042G03 pDONR221 MGC10-E02 BC023988 NM_015609  
HGE096995 M01C042I03 pDONR221 MGC10-E02 BC023988 NM_015609  
HGE097043 M01C042K03 pDONR221 MGC10-E02 BC023988 NM_015609  
HGE097091 M01C042M03 pDONR221 MGC10-E02 BC023988 NM_015609  
HGE097139 M01C042O03 pDONR221 MGC10-E02 BC023988 NM_015609  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR181228 ARi53B04 pGCAP10 NM_015609.3  
AAAAAGCGGCGAGTAAGATGGAAGATGAGGAGGTCGCTGAGAGCTGGGAAGAGGCGGCAG
HKR238670 ARiS096L06 pGCAP10 NM_015609.3  
GGAGGAGGGAAAGCGGCGAGTAAGATGGAAGATGAGGAGGTCGCTGAGAGCTGGGAAGAG
HKR260131 ARiS150F11 pGCAP10 NM_015609.3  
GGGGAAATCCAAATCTCCTCCCAAAGTGCCCATTGTGATTCAGGACGATAGCCTTCCCGC
HKR374081 RBd35D09 pGCAP10 NM_015609.3  
GGAAAGCGGCGAGTAAGATGGAAGATGAGGAGGTCGCTGAGAGCTGGGAAGAGGCGGCAG
HKR391697 RBd79E01 pGCAP10 NM_015609.3  
GGGGGGAGGAGGGAAAGCGGCGAGTAAGATGGAAGATGAGGAGGTCGCTGAGAGCTGGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl