Prev. | 

RIKEN DNA Bank Human Resource - CHTOP

Gene ID NCBI Gene 26097 |  KEGG hsa:26097
Gene Symbol CHTOP
Protein Name chromatin target of PRMT1
Synonyms C10orf77|C1orf77|FL-SRAG|FOP|SRAG|SRAG-3|SRAG-5|pp7704
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY067488 IRAK168L24 pBluescriptR BC070027 NM_015607 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR235308 ARiS088E12 pGCAP10 NM_015607.2  
GGTTTTGGACACCGAGCAGGAGCTGGCGGCCGCTGCAGACGAAAGGCAGGAAAGGGCAGG
HKR238662 ARiS096K22 pGCAP10 NM_015607.2  
GGTTTTGGACACCGAGCAGGAGCTGGCGGCCGCTGCAGACGAAAGGCAGGAAAGGGCAGG
HKR335708 RBb39E12 pGCAP1 NM_015607.2  
TTGGCCGGAGCCGTGGTGGCAGCCCCGGGAGGAGCACTGGCGTCTGTTTCCTTCGATTCT
HKR388580 RBd71H12 pGCAP10 NM_015607.2  
GAGGAGAATCACTTGAACCCGTGAGGCGAAGGTTGCAGTGAGCCAAGATCCTGCCACTGC
HKR395233 RBd88B09 pGCAP10 NM_015607.2  
GGACACCGAGCAGGAGCTGGCGGCCGCTGCAGACGAAAGGCAGGAAAGGGCAGGCCGGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl