Prev. |  KEGG KO K11799 > 

RIKEN DNA Bank Human Resource - DCAF4

Gene ID NCBI Gene 26094 |  KEGG hsa:26094
Gene Symbol DCAF4
Protein Name DDB1 and CUL4 associated factor 4
Synonyms WDR21|WDR21A
Ortholog resource in our bank

  DCAF4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX031414 IRAK078I22 pCMV-SPORT6 BC035901 NM_181340 Full
HGY091262 IRAL028C14 pOTB7 BC018979 NM_181340 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR059773 ARe49H05 pKA1U5 NM_015604.2  
AAAAAACGCATCCACCTAACTGGCTGACGCTACACCTTGGTCTTTCCGGGTCCTTGCACG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl