Prev. |  KEGG KO K10615 > 

RIKEN DNA Bank Human Resource - HERC4

Gene ID NCBI Gene 26091 |  KEGG hsa:26091
Gene Symbol HERC4
Protein Name HECT and RLD domain containing E3 ubiquitin protein ligase 4
Synonyms -
Ortholog resources KEGG ortholog (KEGG orthology K10615) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX033673 IRAK084D01 pCMV-SPORT6 BC039600 NM_022079 Full/var
HGX035219 IRAK088A19 pCMV-SPORT6 BC039465 NM_001017972 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE094436 M01C036B12 pDONR221 MGC07-H06 BC039600 NM_015601  
HGE094484 M01C036D12 pDONR221 MGC07-H06 BC039600 NM_015601  
HGE094532 M01C036F12 pDONR221 MGC07-H06 BC039600 NM_015601  
HGE094580 M01C036H12 pDONR221 MGC07-H06 BC039600 NM_015601  
HGE094628 M01C036J12 pDONR221 MGC07-H06 BC039600 NM_015601  
HGE094676 M01C036L12 pDONR221 MGC07-H06 BC039600 NM_015601  
HGE094724 M01C036N12 pDONR221 MGC07-H06 BC039600 NM_015601  
HGE094772 M01C036P12 pDONR221 MGC07-H06 BC039600 NM_015601  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR235121 ARiS087N09 pGCAP10 NM_022079.2  
GGGGTCGCTGACGGCTGTCTCTGGACTGGACAGCAGTGGCGTCCGCTTTTCTCTAAGGAA
HKR364907 RBd12E11 pGCAP10 NM_022079.2  
GGACGGCTGTCTCTGGACTGGACAGCAGTGGCGTCCGCTTTTCTCTAAGGAACCCGATAA
HKR375698 RBd39E02 pGCAP10 NM_022079.2  
TACTTCCGGCCAGCCCCTCCCCCGCCTCCCTCGCGTGGCCACCTCCCCCTCTGCCTTCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl