Prev. |  KEGG KO K10615 > 

RIKEN DNA Bank Human Resource - HERC4

Gene ID NCBI Gene 26091 |  KEGG hsa:26091
Gene Symbol HERC4
Protein Name HECT and RLD domain containing E3 ubiquitin protein ligase 4
Synonyms -
Ortholog resource in our bank

  HERC4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX033673 IRAK084D01 pCMV-SPORT6 BC039600 NM_022079 Full/var
HGX035219 IRAK088A19 pCMV-SPORT6 BC039465 NM_001017972 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE094436 M01C036B12 pDONR221 MGC07-H06 BC039600 NM_015601  
HGE094484 M01C036D12 pDONR221 MGC07-H06 BC039600 NM_015601  
HGE094532 M01C036F12 pDONR221 MGC07-H06 BC039600 NM_015601  
HGE094580 M01C036H12 pDONR221 MGC07-H06 BC039600 NM_015601  
HGE094628 M01C036J12 pDONR221 MGC07-H06 BC039600 NM_015601  
HGE094676 M01C036L12 pDONR221 MGC07-H06 BC039600 NM_015601  
HGE094724 M01C036N12 pDONR221 MGC07-H06 BC039600 NM_015601  
HGE094772 M01C036P12 pDONR221 MGC07-H06 BC039600 NM_015601  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR235121 ARiS087N09 pGCAP10 NM_022079.2  
GGGGTCGCTGACGGCTGTCTCTGGACTGGACAGCAGTGGCGTCCGCTTTTCTCTAAGGAA
HKR364907 RBd12E11 pGCAP10 NM_022079.2  
GGACGGCTGTCTCTGGACTGGACAGCAGTGGCGTCCGCTTTTCTCTAAGGAACCCGATAA
HKR375698 RBd39E02 pGCAP10 NM_022079.2  
TACTTCCGGCCAGCCCCTCCCCCGCCTCCCTCGCGTGGCCACCTCCCCCTCTGCCTTCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl