Prev. |  KEGG KO K13704 > 

RIKEN DNA Bank Human Resource - ABHD12

Gene ID NCBI Gene 26090 |  KEGG hsa:26090
Gene Symbol ABHD12
Protein Name abhydrolase domain containing 12
Synonyms ABHD12A|BEM46L2|C20orf22|PHARC|dJ965G21.2|hABHD12
Ortholog resource in our bank

  ABHD12

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY091274 IRAL028D02 pOTB7 BC014049 NM_015600 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE084810 M01C012A10 pDONR221 FLJ03-F05 AK075023 ENST00000376517  
HGE084858 M01C012C10 pDONR221 FLJ03-F05 AK075023 ENST00000376517  
HGE084906 M01C012E10 pDONR221 FLJ03-F05 AK075023 ENST00000376517  
HGE084954 M01C012G10 pDONR221 FLJ03-F05 AK075023 ENST00000376517  
HGE085002 M01C012I10 pDONR221 FLJ03-F05 AK075023 ENST00000376517  
HGE085050 M01C012K10 pDONR221 FLJ03-F05 AK075023 ENST00000376517  
HGE085098 M01C012M10 pDONR221 FLJ03-F05 AK075023 ENST00000376517  
HGE085146 M01C012O10 pDONR221 FLJ03-F05 AK075023 ENST00000376517  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR163629 ARi09B05 pGCAP10 NM_001042472.1  
GGCAGCGGCCTGGGCTGGGATGTGAGGAGCGGCGGGTTCCGGGCTCCGGGCTCTGGGTGG
HKR248835 ARiS122B11 pGCAP10 NM_001042472.1  
GACTGCGGCGCAGGCGGCGGAGGCCAGCGGGCGCCGTCGGCGGCTGGCCCTGTCGGCCGC
HKR372105 RBd30E09 pGCAP10 NM_001042472.1  
GGGGCTCTGGGTGGCGGCGGCTGTGAGCGGCGGCACTGCGGCGCAGGCGGCGGAGGCCAG
HKR405716 RBdS014E20 pGCAP10 NM_001042472.1  
GGCAGCGGCCTGGGCTGGGATGTGAGGAGCGGCGGGTTCCGGGCTCCGGGCTCTGGGTGG
HKR428095 RBdS070D23 pGCAP10 NM_001042472.1  
GTCCGGGCTCTGGGTGGCGGCGGCTGTGAGCGGCGGCACTGCGGCGCAGGCGGCGGAGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl