Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ABHD12

Gene ID (NCBI) 26090
Gene Symbol ABHD12
Protein Name abhydrolase domain containing 12
Synonyms ABHD12A|BEM46L2|C20orf22|PHARC|dJ965G21.2
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY091274 IRAL028D02 pOTB7 BC014049 NM_015600 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE084810 M01C012A10 pDONR221 FLJ03-F05 AK075023 ENST00000376517
HGE084858 M01C012C10 pDONR221 FLJ03-F05 AK075023 ENST00000376517
HGE084906 M01C012E10 pDONR221 FLJ03-F05 AK075023 ENST00000376517
HGE084954 M01C012G10 pDONR221 FLJ03-F05 AK075023 ENST00000376517
HGE085002 M01C012I10 pDONR221 FLJ03-F05 AK075023 ENST00000376517
HGE085050 M01C012K10 pDONR221 FLJ03-F05 AK075023 ENST00000376517
HGE085098 M01C012M10 pDONR221 FLJ03-F05 AK075023 ENST00000376517
HGE085146 M01C012O10 pDONR221 FLJ03-F05 AK075023 ENST00000376517

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR163629 ARi09B05 pGCAP10 NM_001042472.1
GGCAGCGGCCTGGGCTGGGATGTGAGGAGCGGCGGGTTCCGGGCTCCGGGCTCTGGGTGG
HKR248835 ARiS122B11 pGCAP10 NM_001042472.1
GACTGCGGCGCAGGCGGCGGAGGCCAGCGGGCGCCGTCGGCGGCTGGCCCTGTCGGCCGC
HKR372105 RBd30E09 pGCAP10 NM_001042472.1
GGGGCTCTGGGTGGCGGCGGCTGTGAGCGGCGGCACTGCGGCGCAGGCGGCGGAGGCCAG
HKR405716 RBdS014E20 pGCAP10 NM_001042472.1
GGCAGCGGCCTGGGCTGGGATGTGAGGAGCGGCGGGTTCCGGGCTCCGGGCTCTGGGTGG
HKR428095 RBdS070D23 pGCAP10 NM_001042472.1
GTCCGGGCTCTGGGTGGCGGCGGCTGTGAGCGGCGGCACTGCGGCGCAGGCGGCGGAGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.11

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl