Prev. | Human A to Z list > G > 

RIKEN DNA Bank Human Resource - GGA1

Gene ID (NCBI) 26088
Gene Symbol GGA1
Protein Name golgi associated, gamma adaptin ear containing, ARF binding protein 1
Synonyms -
Databases KEGG hsa:26088 |  NCBI Gene 26088
Featured content Lysosome (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K12404)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB15366 pGEX-4T-2/hGGA1(GAT) Bacterial Expression vector of human GGA1, the GAT domain.

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY097907 IRAL044M19 pOTB7 BC044629 NM_001001560 Full
HGY082009 IRAL005A09 pOTB7 BC000538 NM_013365 Partial

(1) Please refer Vector Information and Library Method Overviews at MGC.
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR322811 RBb07A11 pKA1U5 NM_013365.3  
GTTGGGCCGAGGCTGGGGGCCGGTGGCGGATGGAGCCCGCGATGGAGCCGGAGACTCTGG
HKR330812 RBb27A12 pGCAP1 NM_013365.3  
ACATGCCCGCAGAGAATTCTTCCGGAGGCGGTCACAGACATCTCCGTGACGCAGAACGAG
HKR363751 RBd09G07 pGCAP10 NM_013365.3  
GGGAGCCCGCGATGGAGCCGGAGACTCTGGAGGCGCGAATCAATAGAGCCACGAACCCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.02.26

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180829.pl