Prev. |  KEGG KO K13237 > 

RIKEN DNA Bank Human Resource - DECR2

Gene ID NCBI Gene 26063 |  KEGG hsa:26063
Gene Symbol DECR2
Protein Name 2,4-dienoyl-CoA reductase 2
Synonyms PDCR|SDR17C1
Ortholog resource in our bank

  DECR2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005619 IRAK014A19 pCMV-SPORT6 BC010740 NM_020664 Full
HGX008685 IRAK021L21 pCMV-SPORT6 BC011968 NM_020664 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR342011 RBb55A11 pGCAP1 NM_020664.3  
GGCAGCTNCGCGCCGGGTCCTGGAGGCCGAGGCCGCTCCCGCCCGTTTGTCCCCGCAGTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl