Prev. |  KEGG KO K12261 > 

RIKEN DNA Bank Human Resource - HACL1

Gene ID NCBI Gene 26061 |  KEGG hsa:26061
Gene Symbol HACL1
Protein Name 2-hydroxyacyl-CoA lyase 1
Synonyms 2-HPCL|HPCL|HPCL2|PHYH2
Ortholog resources KEGG ortholog (KEGG orthology K12261) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083293 IRAL008D21 pOTB7 BC001627 NM_012260 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR189755 ARi74G11 pGCAP10 NM_012260.2  
GAGAGGTGCAGTACCAGAGGTGGCGTGCTGCCGACTTCGCGTTTGCCTTGCTGGATGATT
HKR235567 ARiS088P07 pGCAP10 NM_012260.2  
GAGAGGTGCAGTACCAGAGGTGGCGTGCTGCCGACTTCGCGTTTGCCTTGCTGGATGATT
HKR383703 RBd59E07 pGCAP10 NM_012260.2  
GAGAGGTGCAGTACCAGAGGTGGCGTGCTGCCGACTTCGCGTTTGCCTTGCTGGATGATT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl