Prev. |  KEGG KO K07380 > 

RIKEN DNA Bank Human Resource - CNTNAP2

Gene ID NCBI Gene 26047 |  KEGG hsa:26047
Gene Symbol CNTNAP2
Protein Name contactin associated protein 2
Synonyms AUTS15|CASPR2|CDFE|NRXN4|PTHSL1
Ortholog resources KEGG ortholog (KEGG orthology K07380) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR392953 RBd82G09 pGCAP10 NM_014141.4  
CGGCCGGCCGATGAAAGCTGCCCGCCGGGACTCGGGCTGCCGGCCGACAAAGGACGGTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl