Prev. | 

RIKEN DNA Bank Human Resource - ATRNL1

Gene ID NCBI Gene 26033 |  KEGG hsa:26033
Gene Symbol ATRNL1
Protein Name attractin like 1
Synonyms ALP|bA338L11.1|bA454H24.1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX043148 IRAK107O12 pCMV-SPORT6 BC046219 NM_207303 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE105236 M01C063B12 pDONR221 06_06-D06 AK127277 NM_207303  
HGE105284 M01C063D12 pDONR221 06_06-D06 AK127277 NM_207303  
HGE105332 M01C063F12 pDONR221 06_06-D06 AK127277 NM_207303  
HGE105380 M01C063H12 pDONR221 06_06-D06 AK127277 NM_207303  
HGE105428 M01C063J12 pDONR221 06_06-D06 AK127277 NM_207303  
HGE105476 M01C063L12 pDONR221 06_06-D06 AK127277 NM_207303  
HGE105524 M01C063N12 pDONR221 06_06-D06 AK127277 NM_207303  
HGE105572 M01C063P12 pDONR221 06_06-D06 AK127277 NM_207303  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR177628 ARi44B04 pGCAP10 NM_207303.2  
GGGGCTCCCGGCGCTGCCGCTGCGGCCGGCTCGAGGCACCGGAGACAGAATGGCTGCCGG
HKR260288 ARiS150L24 pGCAP10 NM_207303.2  
GGCCTCCCGCTCCCCGCCTCCGGCCGGGTCCGGGACGCCGCGGCTGTGGGGTCGGCCCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl