Prev. |  KEGG KO K13120 > 

RIKEN DNA Bank Human Resource - FAM32A

Gene ID NCBI Gene 26017 |  KEGG hsa:26017
Gene Symbol FAM32A
Protein Name family with sequence similarity 32 member A
Synonyms OTAG-12|OTAG12
Ortholog resources KEGG ortholog (KEGG orthology K13120) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082141 IRAL005F21 pOTB7 BC000639 NM_014077 Full
HGY083601 IRAL009A01 pOTB7 BC004447 NM_014077 Partial
HGY095814 IRAL039I22 pOTB7 BC017286 NM_014077 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR046811 ARe17A11 pKA1U5 NM_014077.2  
GGGCACTCCAGCTACCGAAGCACTGGAGAGTGTCATGGAGGCCTACGAGCAGGTCCAAAA
HKR050025 ARe25B01 pKA1U5 NM_014077.2  
GACTGGAGAGTGTCATGGAGGCCTACGAGCAGGTCCAAAAGGGACCCCTGAAGCTGAAAG
HKR165370 ARi13H02 pGCAP10 NM_014077.2  
GACTCCAGCTACCGAAGCACTGGAGAGTGTCATGGAGGCCTACGAGCAGGTCCAAAAGGG
HKR336028 RBb40B04 pGCAP1 NM_014077.2  
GACTGGAGAGTGTCATGGAAGGCCTACGAGCAGGTCCAAAAGGGACCCCTGAAGCTGAAA
HKR388802 RBd72A02 pGCAP10 NM_014077.2  
GACTGGAGAGTGTCATGGAGGCCTACGAGCAGGTCCAAAAGGGACCCCTGAAGCTGAAAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl