Prev. |  KEGG KO K00863 > 

RIKEN DNA Bank Human Resource - TKFC

Gene ID NCBI Gene 26007 |  KEGG hsa:26007
Gene Symbol TKFC
Protein Name triokinase and FMN cyclase
Synonyms DAK|NET45
Ortholog resources KEGG ortholog (KEGG orthology K00863) in the DNA Bank
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001832 IRAK004J16 pCMV-SPORT6 BC001341 NM_015533 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR073202 ARe83A02 pKA1U5 NM_015533.3  
GGCCAGCGCCCGCAGGACCCGGATGAGAGCGCACGCTTCGGGGTCTCCGGGAAGTCGCGG
HKR320408 RBb01A08 pKA1U5 NM_015533.3  
GGCCAGCGCCCGCAGGACCCGGATGAGAGCGCACGCTTCGGGGTCTCCGGGAAGTCGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl