Prev. |  KEGG KO K15706 > 

RIKEN DNA Bank Human Resource - RNF167

Gene ID NCBI Gene 26001 |  KEGG hsa:26001
Gene Symbol RNF167
Protein Name ring finger protein 167
Synonyms 5730408C10Rik|LP2254|RING105
Ortholog resources KEGG ortholog (KEGG orthology K15706) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY091106 IRAL027M18 pOTB7 BC010139 NM_015528 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR075256 ARe88C08 pKA1U5 NM_015528.1  
GCTTTCCGCGTTTTATCCCCGNTACCAGAAAAGGATACATTTAGTGCCTCCCACCCAGCT
HKR080879 ARf02D07 pKA1U5 NM_015528.1  
GGCCACCCTTCCCGAAGTTTTTCTGTCACCTGNTGCTTAGGCTCCGNTCCCCTTTCCGCG
HKR277608 ARiS194A08 pGCAP10 NM_015528.1  
GAGTGCCTCCCACCCAGCTCCACTAAACGGGTTGGATATCTCATTCTTTGAGTTGGTGTT
HKR373234 RBd33B10 pGCAP10 NM_015528.1  
GGGAGCTGAAGGAGGAGCTTGATGGAAGCGTGCGAGAAGGGGCGTAACTGATTTGGAAAC
HKR405628 RBdS014B04 pGCAP10 NM_015528.1  
GGAGCTTGATGGAAGCGTGCGAGAAGGGGCGTAACTGATTTGGAAACCAGAGGAAAGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl