Prev. | 

RIKEN DNA Bank Human Resource - HIGD1A

Gene ID NCBI Gene 25994 |  KEGG hsa:25994
Gene Symbol HIGD1A
Protein Name HIG1 hypoxia inducible domain family member 1A
Synonyms HIG1|RCF1a
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082106 IRAL005E10 pOTB7 BC000601 NM_014056 Full/var
HGY088617 IRAL021J01 pDNR-LIB BC009583 NM_014056 Full/var
HGY088679 IRAL021L15 pDNR-LIB BC009594 NM_014056 Full/var
HGY102919 IRAL057E23 pDNR-LIB BC070277 NM_014056 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE100036 M01C050B12 pDONR221 MGC14-H06 BC000601 NM_014056  
HGE100084 M01C050D12 pDONR221 MGC14-H06 BC000601 NM_014056  
HGE100132 M01C050F12 pDONR221 MGC14-H06 BC000601 NM_014056  
HGE100180 M01C050H12 pDONR221 MGC14-H06 BC000601 NM_014056  
HGE100228 M01C050J12 pDONR221 MGC14-H06 BC000601 NM_014056  
HGE100276 M01C050L12 pDONR221 MGC14-H06 BC000601 NM_014056  
HGE100324 M01C050N12 pDONR221 MGC14-H06 BC000601 NM_014056  
HGE100372 M01C050P12 pDONR221 MGC14-H06 BC000601 NM_014056  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR169255 ARi23C07 pGCAP10 NM_014056.3  
GGTGAGAGGTTTTCTCGCTCTAGGGAGATTCTTCAAGCAATCACTATGTCAACAGACACA
HKR177754 ARi44G10 pGCAP10 NM_014056.3  
GGTGGGTGGGGAGAAGCCGGGAGGACTGGGTGCGCCTGCAGGGATCGGAAGCCGGTTGGG
HKR185752 ARi64G08 pGCAP10 NM_014056.3  
HKR187299 ARi68E03 pGCAP10 NM_014056.3  
GGTGAGAGGTTTTCTCGCTCTAGGGAGATTCTTCAAGCAATCACTATGTCAACAGACACA
HKR322954 RBb07G10 pKA1U5 NM_014056.3  
GAGGGATCGGAAGCCGGTTGGGGTGTGAGAGGTTTTCTCGCTCTAGGGAGATTCTTCAAG
HKR326027 RBb15B03 pKA1U5 NM_014056.3  
GAGAAGCCGGGAGGACTGGGTGCGCCTGCAGGGATCGGAAGCCGGTTGGGGTGTGAGAGG
HKR343231 RBb58B07 pGCAP1 NM_014056.3  
GGAGGACTGGGTGCGCCTGCAGGGATCGGAAGCCGGTTGGGGTGTGAGAGGTTTTCTCGC
HKR372055 RBd30C07 pGCAP10 NM_014056.3  
GCTTTTGCGGCCGCTGGCCTCTGATTGGCTGGGACGGCTGTGGGTGGGGAGAAGCCGGGA
HKR386521 RBd66F01 pGCAP10 NM_014056.3  
GGCNCCTGCAGGGATCGGAAGCCGGTTGGGGTGTGAGAGGTTTTCTCGCTCTAGGGAGAT
HKR394573 RBd86H05 pGCAP10 NM_014056.3  
GAGCCGGTTGGGGTGTGAGAGGTTTTCTCGCTCTAGGGAGATTCTTCAAGCAATCACTAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl