Prev. | 

RIKEN DNA Bank Human Resource - HINFP

Gene ID NCBI Gene 25988 |  KEGG hsa:25988
Gene Symbol HINFP
Protein Name histone H4 transcription factor
Synonyms HiNF-P|MIZF|ZNF743
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX008669 IRAK021L05 pCMV-SPORT6 BC012856 NM_198971 Full/var
HGY081005 IRAL002I13 pOTB7 BC001073 NM_198971 Full/var
HGY083619 IRAL009A19 pOTB7 BC001945 NM_198971 Full/var
HGY090901 IRAL027E05 pOTB7 BC017234 NM_198971 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE022564 W01A056G20 pENTR-TOPO flj0003i17 AK056362 NM_198971  
HGE022568 W01A056G24 pENTR-TOPO flj0003i17 AK056362 NM_198971  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR340498 RBb51E02 pGCAP1 NM_015517.3  
GGGAGATGGTCTGAGGTGGGAGAAGAGCTGAAGAGACCTGGAGCCGACAGACGGGTGAAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl