Prev. | 

RIKEN DNA Bank Human Resource - UNC50

Gene ID NCBI Gene 25972 |  KEGG hsa:25972
Gene Symbol UNC50
Protein Name unc-50 inner nuclear membrane RNA binding protein
Synonyms GMH1|HSD23|PDLs22|UNCL|URP
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX008900 IRAK022E04 pCMV-SPORT6 BC017019 NM_014044 Full
HGY013809 IRAK034I17 pBluescriptR BC025992 NM_014044

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR164570 ARi11H02 pGCAP10 NM_014044.5  
GGCCCCAAGGGCCGGCTCCGTTGAGGGAAGGGAAGCCCGCCCGGTGGCGGCTGGGGTCGG
HKR164977 ARi12H09 pGCAP10 NM_014044.5  
GAGGGCCGGCTCCGTTGAGGGAAGGGAAGCCCGCCCGGTGGCGGCTGGGGTCGGCTGCTG
HKR222212 ARiS055I20 pGCAP10 NM_014044.5  
GCGGCTCCGTTGAGGGAAGGGAAGCCCGCCCGGTGGCGGCTGGGGTCGGCTGCTGGGAGG
HKR331706 RBb29E10 pGCAP1 NM_014044.5  
AAGGGCCGGCTCCGTTGAGGGAAGGGAAGCCCGCCCGGTGGCGGCTGGGGTCGGCTGCTG
HKR403155 RBdS007O19 pGCAP10 NM_014044.5  
GAAGGGCCGGCTCCGTTGAGGGAAGGGAAGCCCGCCCGGTGGCGGCTGGGGTCGGCTGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl