Prev. |  KEGG KO K12459 > 

RIKEN DNA Bank Human Resource - SH2B1

Gene ID NCBI Gene 25970 |  KEGG hsa:25970
Gene Symbol SH2B1
Protein Name SH2B adaptor protein 1
Synonyms PSM|SH2B
Ortholog resource in our bank

  SH2B1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005320 IRAK013E24 pCMV-SPORT6 BC010704 NM_015503 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE086038 M01C015B14 pDONR221 FLJ05-D07 AK055104 ENST00000359285  
HGE086086 M01C015D14 pDONR221 FLJ05-D07 AK055104 ENST00000359285  
HGE086134 M01C015F14 pDONR221 FLJ05-D07 AK055104 ENST00000359285  
HGE086182 M01C015H14 pDONR221 FLJ05-D07 AK055104 ENST00000359285  
HGE086230 M01C015J14 pDONR221 FLJ05-D07 AK055104 ENST00000359285  
HGE086278 M01C015L14 pDONR221 FLJ05-D07 AK055104 ENST00000359285  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR364428 RBd11B04 pGCAP10 NM_015503.1  
GGGGCTGGGCGCTCGTCGCGTAGTGGGTGGGGGCGCAGGGAGCGGGAGCCGCCGCCGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl