Prev. |  KEGG KO K13170 > 

RIKEN DNA Bank Human Resource - PNISR

Gene ID NCBI Gene 25957 |  KEGG hsa:25957
Gene Symbol PNISR
Protein Name PNN interacting serine and arginine rich protein
Synonyms C6orf111|HSPC306|SFRS18|SRrp130|bA98I9.2
Ortholog resources KEGG ortholog (KEGG orthology K13170) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX046301 IRAK115M13 pCMV-SPORT6 BC052638 NM_032870 Partial/var
HGX055970 IRAK139P10 pCMV-SPORT6 BC064640 NM_032870 Partial/var
HGY088021 IRAL020A21 pOTB7 BC007791 NM_032870 Partial/var
HGY090123 IRAL025F03 pOTB7 BC012780 NM_032870 Partial/var
HGY095981 IRAL039P21 pOTB7 BC019074 NM_032870 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE122422 M01C106A22 pDONR221 06_13-F11 AK074628 ENST00000369239  
HGE122470 M01C106C22 pDONR221 06_13-F11 AK074628 ENST00000369239  
HGE122518 M01C106E22 pDONR221 06_13-F11 AK074628 ENST00000369239  
HGE125631 M01C114B07 pDONR221 06-2_05-G04 AK074628 ENST00000369239  
HGE125679 M01C114D07 pDONR221 06-2_05-G04 AK074628 ENST00000369239  
HGE125727 M01C114F07 pDONR221 06-2_05-G04 AK074628 ENST00000369239  
HGE125775 M01C114H07 pDONR221 06-2_05-G04 AK074628 ENST00000369239  
HGE125823 M01C114J07 pDONR221 06-2_05-G04 AK074628 ENST00000369239  
HGE125871 M01C114L07 pDONR221 06-2_05-G04 AK074628 ENST00000369239  
HGE125919 M01C114N07 pDONR221 06-2_05-G04 AK074628 ENST00000369239  
HGE125967 M01C114P07 pDONR221 06-2_05-G04 AK074628 ENST00000369239  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE015601 W01A039A01 pENTR-TOPO flj0017n06 AK074628 NM_032870  
HGE015605 W01A039A05 pENTR-TOPO flj0017n06 AK074628 NM_032870  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR186901 ARi67E05 pGCAP10 NM_032870.2  
GAGAAGCATCGAAAGCGTTGGAGAGGTGTTACCGGAACGGCGGCGACCAGGGTGTTCCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl