Prev. |  KEGG KO K12868 > 

RIKEN DNA Bank Human Resource - SYF2

Gene ID NCBI Gene 25949 |  KEGG hsa:25949
Gene Symbol SYF2
Protein Name SYF2 pre-mRNA splicing factor
Synonyms CBPIN|NTC31|P29|fSAP29
Ortholog resource in our bank

  SYF2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005623 IRAK014A23 pCMV-SPORT6 BC010862 -
HGY087644 IRAL019B20 pDNR-LIB BC015824 -

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR081349 ARf03G05 pKA1U5 NM_015484.4  
GGGGAAGAGAGAAAGGTTGTGATGGCGGCTATAGCTGCATCCGAGGTGCTGGTGGACAGC
HKR337330 RBb43F10 pGCAP1 NM_015484.4  
GGAGAAAGGTTGTGATGGCGGCTATAGCTGCATCCGAGGTGAGTTCCACCCACCGNTACA
HKR378951 RBd47G07 pGCAP10 NM_015484.4  
GGGGAAGAGAGAAAGGTTGTGATGGCGGCTATAGCTGCATCCGAGGTGCTGGTGGACAGC
HKR385254 RBd63C06 pGCAP10 NM_015484.4  
GAAGTGGGAAGAGAGAAAGGTTGTGATGGCGGCTATAGCTGCATCCGAGGTGCTGGTGGA
HKR403059 RBdS007K19 pGCAP10 NM_015484.4  
GGAGAAAGGTTGTGATGGCGGCTATAGCTGCATCCGAGGTGCTGGTGGACAGCGCGGAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl