Prev. | 

RIKEN DNA Bank Human Resource - FAM98A

Gene ID NCBI Gene 25940 |  KEGG hsa:25940
Gene Symbol FAM98A
Protein Name family with sequence similarity 98 member A
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX025624 IRAK064A24 pCMV-SPORT6 BC038581 NM_015475 Partial
HGY053236 IRAK133B12 pBluescript BC060860 NM_015475 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE085213 M01C013A13 pDONR221 FLJ04-A07 AK074867 NM_015475  
HGE085261 M01C013C13 pDONR221 FLJ04-A07 AK074867 NM_015475  
HGE085309 M01C013E13 pDONR221 FLJ04-A07 AK074867 NM_015475  
HGE085357 M01C013G13 pDONR221 FLJ04-A07 AK074867 NM_015475  
HGE085405 M01C013I13 pDONR221 FLJ04-A07 AK074867 NM_015475  
HGE085453 M01C013K13 pDONR221 FLJ04-A07 AK074867 NM_015475  
HGE085501 M01C013M13 pDONR221 FLJ04-A07 AK074867 NM_015475  
HGE085549 M01C013O13 pDONR221 FLJ04-A07 AK074867 NM_015475  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR471112 RBdS177M24 pGCAP10 NM_015475.3  
GCTGACGACTCGGAAATTTGAATACCACAGTAGCATGGAGTGTGACCTCATGGAGACTGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl