Prev. |  KEGG KO K11545 > 

RIKEN DNA Bank Human Resource - NSL1

Gene ID NCBI Gene 25936 |  KEGG hsa:25936
Gene Symbol NSL1
Protein Name NSL1 component of MIS12 kinetochore complex
Synonyms C1orf48|DC8|MIS14
Ortholog resource in our bank

  NSL1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY019338 IRAK048F18 pBluescriptR BC036048 NM_015471 Full/var
HGY086668 IRAL016L04 pDNR-LIB BC007067 NM_015471 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR380477 RBd51D05 pGCAP10 NM_015471.3  
GACCCAGGATCTTAGGATTCAGAAAGATCCCACGCCAGGCCTTGGCAGAATTAACGGTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl