Prev. |  KEGG KO K05024 > 

RIKEN DNA Bank Human Resource - CLIC4

Gene ID NCBI Gene 25932 |  KEGG hsa:25932
Gene Symbol CLIC4
Protein Name chloride intracellular channel 4
Synonyms CLIC4L|H1|MTCLIC|huH1|p64H1
Ortholog resource in our bank

  CLIC4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX008528 IRAK021F08 pCMV-SPORT6 BC012444 NM_013943 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2021Apr07.csv
GNP_full_IRAL_2021Apr13.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042408 ARe06A08 pKA1U5 NM_013943.2 done
GAGTCCAGCGAGCAGCACGGCGGGAACCGGCAGCCGGAGCAGTCCCGGAGCAGAAGCAGC
HKR048059 ARe20C11 pKA1U5 NM_013943.2  
GGTGGCGCGGGGGGCGTGGGGCGGTGCTGAGGAGCTGAAGCCGTGGCCAGCTCGACGCCG
HKR064179 ARe60H11 pKA1U5 NM_013943.2  
GAGTCCAGCGAGCAGCACGGCGGGAACCGGCAGCCGGAGCAGTCCCGGAGCAGAAGCAGC
HKR070503 ARe76E07 pKA1U5 NM_013943.2  
GAGTCCAGCGAGCAGCACGGCGGGAACCGGCAGCCGNAGCAGTCCCGGAGCAGAAGCAGC
HKR165731 ARi14F11 pGCAP10 NM_013943.2  
GGCCGGACAGTCCAGCGAGCAGCACGGCGGGAACCGGCAGCCGGAGCAGTCCCGGAGCAG
HKR176927 ARi42F07 pGCAP10 NM_013943.2  
GGCTGAGGAGCTGAAGCCGTGGCCAGCTCGACGCCGGACAGTCCAGCGAGCAGCACGGCG
HKR179704 ARi49E08 pGCAP10 NM_013943.2  
GAGTCCAGCGAGCAGCACGGCGGGAACCGGCAGCCGGAGCAGTCCCGGAGCAGAAGCAGC
HKR277944 ARiS194O08 pGCAP10 NM_013943.2  
GAGTCCAGCGAGCAGCACGGCGGGAACCGGCAGCCGGAGCAGTCCCGGAGCAGAAGCAGC
HKR326953 RBb17G09 pKA1U5 NM_013943.2  
GAGCGAGCAGCACGGCGGGAACCGGCAGCCGGAGCAGTCCCGGAGCAGAAGCAGCAGCAG
HKR376076 RBd40D04 pGCAP10 NM_013943.2  
GAGTCCAGCGAGCAGCACGGCGGGAACCGGCAGCCGGAGCAGTCCCGGAGCAGAAGCAGC
HKR381229 RBd53B05 pGCAP10 NM_013943.2  
TGGGCTGGCTCAGAGTGGCGCGGGGGGCGTGGGGCGGTGCTGAGGAGCTGAAGCCGTGGC
HKR428015 RBdS070A15 pGCAP10 NM_013943.2  
NGAGCTCNNCGCCNGACAGTCNNGNGAGCAGCACGGCGGGAACCGGCAGCCGGAGCAGTC
HKR428224 RBdS070J08 pGCAP10 NM_013943.2  
GAGAGTGGCGCGGGGGGCGTGGGGCGGTGCTGAGGAGCTGAAGCCGTGGCCAGCTCGACG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.04.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl