Prev. |  KEGG KO K13133 > 

RIKEN DNA Bank Human Resource - GEMIN5

Gene ID NCBI Gene 25929 |  KEGG hsa:25929
Gene Symbol GEMIN5
Protein Name gem nuclear organelle associated protein 5
Synonyms GEMIN-5
Ortholog resources KEGG ortholog (KEGG orthology K13133) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX035239 IRAK088B15 pCMV-SPORT6 BC040931 NM_015465 Partial
HGY081732 IRAL004F12 pOTB7 BC008776 NM_015465 Partial
HGY092006 IRAL030A06 pOTB7 BC014147 NM_015465 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR075722 ARe89F02 pKA1U5 NM_015465.3  
GGCCCCGCTCCCTACCTAAGGCGTGAGGCTACGAGCGGTCGGCTGTGGCAGCTTCTCTTG
HKR320524 RBb01F04 pKA1U5 NM_015465.3  
GAGGCTACGAGCGGCCGGCTGTGGCAGCTTCTCTTGTCTCTGACGGNTTGTAGCTTATGG
HKR369208 RBd23A08 pGCAP10 NM_015465.3  
GGAGCGGTCGGCTGTGGCAGCTTCTCTTGTCTCTGACGGCTTGTAGTTATGGGGCAGGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl