Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NOL11

Gene ID (NCBI) 25926
Gene Symbol NOL11
Protein Name nucleolar protein 11
Synonyms -
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX055650 IRAK139C02 pCMV-SPORT6 BC064404 NM_015462 Full
HGY083265 IRAL008C17 pOTB7 BC001726 NM_015462 Partial

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR205394 ARiS013I02 pGCAP10 NM_015462.3  
GAGGTTTGCTCAAAATGGCAGCGCTGGAGGAAGAATTCACGTTGTCTTCGGTAGTCCTGA
HKR387210 RBd68A10 pGCAP10 NM_015462.3  
TGGGTACTTAGGTTTGCTCAAAATGGCAGCGCTGGAGGAAGAATTCACGTTGTCTTCGGT
HKR405483 RBdS013L19 pGCAP10 NM_015462.3  
GGCGGCCGTACTTAGGTTTGCTCAAAATGGCAGCGCTGGAGGAAGAATTCACGTTGTCTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.29

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl