Prev. |  KEGG KO K17339 > 

RIKEN DNA Bank Human Resource - ATL3

Gene ID NCBI Gene 25923 |  KEGG hsa:25923
Gene Symbol ATL3
Protein Name atlastin GTPase 3
Synonyms HSN1F
Ortholog resource in our bank

  ATL3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY101784 IRAL054H16 pOTB7 BC077727 NM_015459 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE083620 M01C009A20 pDONR221 FLJ02-B10 AK090822 NM_015459  
HGE083668 M01C009C20 pDONR221 FLJ02-B10 AK090822 NM_015459  
HGE083716 M01C009E20 pDONR221 FLJ02-B10 AK090822 NM_015459  
HGE083764 M01C009G20 pDONR221 FLJ02-B10 AK090822 NM_015459  
HGE083812 M01C009I20 pDONR221 FLJ02-B10 AK090822 NM_015459  
HGE083860 M01C009K20 pDONR221 FLJ02-B10 AK090822 NM_015459  
HGE083908 M01C009M20 pDONR221 FLJ02-B10 AK090822 NM_015459  
HGE083956 M01C009O20 pDONR221 FLJ02-B10 AK090822 NM_015459  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR177259 ARi43C11 pGCAP10 NM_015459.3  
GGCACCCCTACTGCTTCTGCTTTGAAGGCGGAGGCTCCATGTTGTCCCCTCAGCGAGTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl