Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NELFB

Gene ID (NCBI) 25920
Gene Symbol NELFB
Protein Name negative elongation factor complex member B
Synonyms COBRA1|NELF-B
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K15180)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY091352 IRAL028G08 pOTB7 BC011892 NM_015456 Partial

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE049238 W01A123B14 pENTR-TOPO flj0016g06 AK091056 NM_015456  
HGE049836 W01A124J20 pENTR-TOPO flj0016g06 AK091056 NM_015456  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR047776 ARe19H08 pKA1U5 NM_015456.3  
TGGGCGGGCGGGACCTGGCCGAGCTGGAGGGCGCCNGGGAGCGGGGCTCGGGCGGTCCCC
HKR384122 RBd60F02 pGCAP10 NM_015456.3  
GGGAAGTGGGCGGCTGCGGGACGCGCGCGGAGTCGCGCGGCGGGCGGGACCTGGCCGAGC
HKR387746 RBd69G02 pGCAP10 NM_015456.3  
GGTGGGCGGCTGCGGGACGCGCGCGGAGTCGCGCGGCGGGCGGGACCTGGCCGAGCTGGA
HKR432567 RBdS081G23 pGCAP10 NM_015456.3  
GGGCTGCGGGACGCGCGCGGAGTCGCGCGGCGGGCGGGACCTGGCCGAGCTGGAGGGCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.29

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl