Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NDUFAF3

Gene ID (NCBI) 25915
Gene Symbol NDUFAF3
Protein Name NADH dehydrogenase (ubiquinone) complex I, assembly factor 3
Synonyms 2P1|C3orf60|E3-3
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K09008)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY086071 IRAL015C23 pOTB7 BC002873 NM_199417 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE037204 W01A093A04 pENTR-TOPO IRAL015C23 BC002873 NM_199417  
HGE037206 W01A093A06 pENTR-TOPO IRAL015C23 BC002873 NM_199417  
HGE037208 W01A093A08 pENTR-TOPO IRAL015C23 BC002873 NM_199417  
HGE037210 W01A093A10 pENTR-TOPO IRAL015C23 BC002873 NM_199417  
HGE037212 W01A093A12 pENTR-TOPO IRAL015C23 BC002873 NM_199417  
HGE037557 W01A093O21 pENTR-TOPO IRAL015C23 BC002873 NM_199417  
HGE037559 W01A093O23 pENTR-TOPO IRAL015C23 BC002873 NM_199417  
HGE045497 W01A113M09 pENTR-TOPO IRAL015C23 BC002873 NM_199417  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR082169 ARf05H01 pKA1U5 NM_199069.1  
GGCCCCGCCCACGGTGCCCGAAGCCCCAAAGGCTGGAATTAGGGGCTAGAAGTCTGGCAC
HKR082905 ARf07E09 pKA1U5 NM_199069.1  
GAATTAGGGGCTAGAAGTCTGGCACCCACCGCCTGGCCAGGTGTTCGGGACGCGACCAGG
HKR045250 ARe13C02 pKA1U5 NM_199069.1  
GAGCCATGGCCACCGCTCTCGCGCTACGTAGCTTGTACCGAGCGCGACCCTCGCTGCGCT
HKR169355 ARi23G11 pGCAP10 NM_199069.1  
GGACTTCGCCGCGCGTTGGTCAGCCATGGCCACCGCTCTCGCGCTACGTAGCTTGTACCG
HKR187332 ARi68F12 pGCAP10 NM_199069.1  
TGCCCGCCCACGGTGCCCGAAGCCCCAAAGGCTGGAATTAGGGGCTAGAAGTCTGGCACC
HKR209253 ARiS023C05 pGCAP10 NM_199069.1  
GGTGCCCGAAGCCCCAAAGGCTGGAATTAGGGGCTAGAAGTCTGGCACCCACCGCCTGGC
HKR234844 ARiS087B20 pGCAP10 NM_199069.1  
GGACTTCGCCGCGCGTTGGTCAGCCATGGCCACCGCTCTCGCGCTACGTAGCTTGTACCG
HKR371721 RBd29F01 pGCAP10 NM_199069.1  
HKR371746 RBd29G02 pGCAP10 NM_199069.1  
GGACTTCGCCGCGCGTTGGTCAGCCATGGCCACCGCTCTCGCGCTACGTAGCTTGTACCG
HKR345324 RBb63F04 pGCAP1 NM_199069.1  
AGGGGGACTAACGGCGCCGGTGACGACTTCGCCGCGCGTTGGTCAGCCATGGCCACCGCT
HKR394027 RBd85B03 pGCAP10 NM_199069.1  
GAGGGCCCTCCCAACCCGGGGACTAACGGCGCCGGTGACGACTTCGCCGCGCGTTGGTCA
HKR432525 RBdS081F05 pGCAP10 NM_199069.1  
GGACTTCGCCGCGCGTTGGTCAGCCATGGCCACCGCTCTCGCGCTACGTAGCTTGTACCG
HKR461658 RBdS154C10 pGCAP10 NM_199069.1  
GGCCGCGCGTTGGTCAGCCATGGCCACCGCTCTCGCGCTACGTAGCTTGTACCGAGCGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.29

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl